Journal: Plant Methods

Article Title: NEATTILL: A simplified procedure for nucleic acid extraction from arrayed tissue for TILLING and other high-throughput reverse genetic applications

doi: 10.1186/1746-4811-6-3

Figure Lengend Snippet: Genomic DNA quality and PCR amplification of DNA isolated using different modifications A- Gel electrophoresis of DNA Lane . 1: Tissue was homogenized in extraction buffer (0.1 M Tris-HCl, pH 7.5; 0.05 M EDTA, pH 8.0; 1.25% (w/v) SDS), Lane 2: Same as lane 1 with additional step of PCI (25:24:1). The DNA pellet after dissolving in 200 μl of milliQ water was extracted with an equal volume of PCI. The aqueous phase was collected and DNA was reprecipitated and dissolved in milliQ water, Lane 3: Same as lane 1 with inclusion of 2% (w/v) PVP and 0.2 M β-ME during extraction and PCI extraction was done as for lane 2, Lane 4: Same as in lane 3 but without PCI step, Lane 5: Same as in lane 3 but without β-ME, Lane 6: Same as lane 1 with inclusion of 2% (w/v) PVP during extraction, Lane 7: Same as lane 1 with inclusion of 30 mg PVPP and 0.2 M β-ME during extraction and PCI extraction as done for lane 2, Lane 8: Same as lane 1 with inclusion of 30 mg PVPP and 0.2 M β-ME during extraction, Lane 9: Same as lane 1 with inclusion of 30 mg PVPP during extraction, Lane 10: DNA isolated by Qiagen kit. Abbreviations: PCI-phenol:chloroform:isoamyl alcohol, β-ME-β-mercaptoehanol, PVP-Polyvinylpyrrolidone, PVPP-Polyvinylpolypyrrolidone. B- PCR amplification of isolated DNA. The quality of DNA was checked by PCR amplification of actin gene using forward primer 5'TAACCCAAAAGCCAATCGAG3' and reverse primer 5'AGCTTCCATTCCGATCATTG3'.

Article Snippet: The equipments used were capable of accommodating 96 well plasticwares: high speed centrifuge (Evolution RC, Sorvall with SH-3000 swinging bucket rotor capable of accommodating 4 deepwell plates at a time), 96 well pipettor (PP550 DS, Apricot Designs), Mini Bead Beater (BioSpec Products Inc.); PCR machine (DNA Engine Tetrad 2, MJ Research), 4300 DNA Analyzer (Li-COR Biosciences).

Techniques: Amplification, Isolation, Nucleic Acid Electrophoresis, Extraction

Journal: Plant Methods

Article Title: NEATTILL: A simplified procedure for nucleic acid extraction from arrayed tissue for TILLING and other high-throughput reverse genetic applications

doi: 10.1186/1746-4811-6-3

Figure Lengend Snippet: Evaluation of DNA quality and stability during long-term storage at 4°C . A- Integrity of DNA isolated in 96 deepwell plate after EtBr staining on agarose gel; B- Long term stability (Top panel) and PCR amplification (bottom panel) of nucleic acids. The DNA afer isolation (labeled 1-7 ) was suspended in either TE/RNase (Lane 1-6) or water (Lane 7) and stored at 4°C. At different time periods (0, 4, 9 and 15 months) from isolation DNA was checked for integrity using agarose gel electrophoresis. The quality of DNA was checked by PCR amplification of actin gene (primers as in Fig. 2) using aliquots from stored DNA at 3, 6 and 15 months. M-Markers, Mo-Months.

Article Snippet: The equipments used were capable of accommodating 96 well plasticwares: high speed centrifuge (Evolution RC, Sorvall with SH-3000 swinging bucket rotor capable of accommodating 4 deepwell plates at a time), 96 well pipettor (PP550 DS, Apricot Designs), Mini Bead Beater (BioSpec Products Inc.); PCR machine (DNA Engine Tetrad 2, MJ Research), 4300 DNA Analyzer (Li-COR Biosciences).

Techniques: Isolation, Staining, Agarose Gel Electrophoresis, Amplification, Labeling